Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3042652
End position: 3042675
Length: 24

DNA sequence
>NC_015671, from 3042652 to 3042675 (24 bp); Cellvibrio gilvus ATCC 13127 CGGCGTCGGCCTCGTCGTCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3042438-3043007	Sequence	Celgi_2741 - hypothetical protein (Protein is coded in complementary strand; from 3043007 to 3042438)