Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3140959
End position: 3140982
Length: 24

DNA sequence
>NC_015671, from 3140959 to 3140982 (24 bp); Cellvibrio gilvus ATCC 13127 GTGCGCGTACGCGAGCGCGTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3140513-3141913	Sequence	Celgi_2846 - integral membrane sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 3141913 to 3140513)