Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3236326
End position: 3236349
Length: 24

DNA sequence
>NC_015671, from 3236326 to 3236349 (24 bp); Cellvibrio gilvus ATCC 13127 GCCGCCGCCACCCCCGCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3235676-3236653	Sequence	Celgi_2937 - molecular chaperone DnaJ (Protein is coded in complementary strand; from 3236653 to 3235676)