Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3355672
End position: 3355695
Length: 24

DNA sequence
>NC_015671, from 3355672 to 3355695 (24 bp); Cellvibrio gilvus ATCC 13127 AGCACCACCACCAGCACCAGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3355534-3355908	Sequence	Celgi_3046 - monovalent cation/proton antiporter, MnhG/PhaG subunit (Protein is coded in complementary strand; from 3355908 to 3355534)