Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3357777
End position: 3357800
Length: 24

DNA sequence
>NC_015671, from 3357777 to 3357800 (24 bp); Cellvibrio gilvus ATCC 13127 CAGCAGCAGCACCTGCAGCACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3356860-3358431	Sequence	Celgi_3049 - NADH/Ubiquinone/plastoquinone (complex I) (Protein is coded in complementary strand; from 3358431 to 3356860)