Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3411856
End position: 3411879
Length: 24

DNA sequence
>NC_015671, from 3411856 to 3411879 (24 bp); Cellvibrio gilvus ATCC 13127 CGGGCTCGGCCTCGGGCGCGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3411357-3411905	Sequence	Celgi_3094 - hypothetical protein (Protein is coded in complementary strand; from 3411905 to 3411357)