Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3414622
End position: 3414645
Length: 24

DNA sequence
>NC_015671, from 3414622 to 3414645 (24 bp); Cellvibrio gilvus ATCC 13127 GCTCGGCCTCGGGCTCGAGCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3414207-3414803	Sequence	Celgi_3097 - hypothetical protein (Protein is coded in complementary strand; from 3414803 to 3414207)