Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3439151
End position: 3439174
Length: 24

DNA sequence
>NC_015671, from 3439151 to 3439174 (24 bp); Cellvibrio gilvus ATCC 13127 CGAGCGCGAGCGCGACCGCGAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3438637-3439599	Sequence	Celgi_3120 - ABC transporter related protein (Protein is coded in complementary strand; from 3439599 to 3438637)