Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3446056
End position: 3446079
Length: 24

DNA sequence
>NC_015671, from 3446056 to 3446079 (24 bp); Cellvibrio gilvus ATCC 13127 CGGCCGCGACCGAGGCCGCGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3445665-3447602	Sequence	Celgi_3126 - penicillin-binding protein transpeptidase (Protein is coded in complementary strand; from 3447602 to 3445665)