Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 434616
End position: 434639
Length: 24

DNA sequence
>NC_015671, from 434616 to 434639 (24 bp); Cellvibrio gilvus ATCC 13127 AGGGCGAGGCCGAGCGCGAGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 434166-434690	Sequence	Celgi_0392 - putative lipoprotein (Protein is coded in complementary strand; from 434690 to 434166)