Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 467406
End position: 467429
Length: 24

DNA sequence
>NC_015671, from 467406 to 467429 (24 bp); Cellvibrio gilvus ATCC 13127 GCCGCGGCGGCGGCCGTGGTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 466965-468401	Sequence	Celgi_0424 - glycoside hydrolase 15-related protein (Protein is coded in complementary strand; from 468401 to 466965)