Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 671633
End position: 671656
Length: 24

DNA sequence
>NC_015671, from 671633 to 671656 (24 bp); Cellvibrio gilvus ATCC 13127 AGCGCGAGCGCGAGCACGAGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 671054-671701	Sequence	Celgi_0615 - hypothetical protein (Protein is coded in complementary strand; from 671701 to 671054)