Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 794921
End position: 794944
Length: 24

DNA sequence
>NC_015671, from 794921 to 794944 (24 bp); Cellvibrio gilvus ATCC 13127 CGCGGCCGCGGTCGCCGCCGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 794187-795428	Sequence	Celgi_0726 - AMP-dependent synthetase/ligase (Protein is coded in complementary strand; from 795428 to 794187)