Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 828612
End position: 828635
Length: 24

DNA sequence
>NC_015671, from 828612 to 828635 (24 bp); Cellvibrio gilvus ATCC 13127 AGCGCGAGCGCGAGCACGAGCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 826137-830105	Sequence	Celgi_0752 - cell division protein FtsK/SpoIIIE (Protein is coded in complementary strand; from 830105 to 826137)