Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 860637
End position: 860660
Length: 24

DNA sequence
>NC_015671, from 860637 to 860660 (24 bp); Cellvibrio gilvus ATCC 13127 CCACGCCCACGTCGACGCCCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 860018-861040	Sequence	Celgi_0780 - adenosine deaminase (Protein is coded in complementary strand; from 861040 to 860018)