Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 902078
End position: 902101
Length: 24

DNA sequence
>NC_015671, from 902078 to 902101 (24 bp); Cellvibrio gilvus ATCC 13127 TGACGGTCACGGTGACCGTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 901618-906216	Sequence	Celgi_0814 - coagulation factor 5/8 type domain protein (Protein is coded in complementary strand; from 906216 to 901618)