Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 934004
End position: 934027
Length: 24

DNA sequence
>NC_015671, from 934004 to 934027 (24 bp); Cellvibrio gilvus ATCC 13127 GCGCTCGCGATCGCGCGCGAGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 932316-935021	Sequence	Celgi_0851 - ATPase, P-type (transporting), HAD superfamily, subfamily IC