Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 947124
End position: 947147
Length: 24

DNA sequence
>NC_015671, from 947124 to 947147 (24 bp); Cellvibrio gilvus ATCC 13127 CGCGGGCGCGAGCGCGAGCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 946924-947379	Sequence	Celgi_0865 - hypothetical protein (Protein is coded in complementary strand; from 947379 to 946924)