Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 999160
End position: 999183
Length: 24

DNA sequence
>NC_015671, from 999160 to 999183 (24 bp); Cellvibrio gilvus ATCC 13127 GACGGCGACGACGTCGGCGATGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 997782-999359	Sequence	Celgi_0915 - methyl-accepting chemotaxis sensory transducer with Cache sensor