Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 374017
End position: 374041
Length: 25

DNA sequence
>NC_015671, from 374017 to 374041 (25 bp); Cellvibrio gilvus ATCC 13127 GCCGGGTCGGGCCGCGCCGTGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 373802-375208	Sequence	Celgi_0334 - peptidase M15B and M15C DD-carboxypeptidase VanY/endolysin