Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 387182
End position: 387206
Length: 25

DNA sequence
>NC_015671, from 387182 to 387206 (25 bp); Cellvibrio gilvus ATCC 13127 GCCGGACCGGGCCGCGCCGGGCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 386869-387588	Sequence	Celgi_0346 - hypothetical protein (Protein is coded in complementary strand; from 387588 to 386869)