Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1100072
End position: 1100098
Length: 27

DNA sequence
>NC_015671, from 1100072 to 1100098 (27 bp); Cellvibrio gilvus ATCC 13127 CGACGATCACGCCGATCACGACGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1100002-1100964	Sequence	Celgi_1012 - hypothetical protein (Protein is coded in complementary strand; from 1100964 to 1100002)