Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1660869
End position: 1660895
Length: 27

DNA sequence
>NC_015671, from 1660869 to 1660895 (27 bp); Cellvibrio gilvus ATCC 13127 CTCGAGCGCCTCGAACGCCTCGTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1659625-1661247	Sequence	Celgi_1514 - phytoene desaturase (Protein is coded in complementary strand; from 1661247 to 1659625)