Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2408869
End position: 2408895
Length: 27

DNA sequence
>NC_015671, from 2408869 to 2408895 (27 bp); Cellvibrio gilvus ATCC 13127 CCAGGTCGGCGAGGTCGGCCAGGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2407362-2409491	Sequence	Celgi_2201 - 4-alpha-glucanotransferase (Protein is coded in complementary strand; from 2409491 to 2407362)