Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2590213
End position: 2590239
Length: 27

DNA sequence
>NC_015671, from 2590213 to 2590239 (27 bp); Cellvibrio gilvus ATCC 13127 GCTCGCGCTGTTCGCGCTGCTCGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2589936-2590679	Sequence	Celgi_2362 - binding-protein-dependent transport systems inner membrane component