Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2725956
End position: 2725982
Length: 27

DNA sequence
>NC_015671, from 2725956 to 2725982 (27 bp); Cellvibrio gilvus ATCC 13127 CGCGCGCAGCACGCGCAGCGGGCGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2725939-2727150	Sequence	Celgi_2457 - N-acetylglucosamine-6-phosphate deacetylase (Protein is coded in complementary strand; from 2727150 to 2725939)