Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2949436
End position: 2949462
Length: 27

DNA sequence
>NC_015671, from 2949436 to 2949462 (27 bp); Cellvibrio gilvus ATCC 13127 GGTCCACGTGGTCCAGGTGGTCCGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2949333-2949968	Sequence	Celgi_2644 - hypothetical protein (Protein is coded in complementary strand; from 2949968 to 2949333)