Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3055770
End position: 3055796
Length: 27

DNA sequence
>NC_015671, from 3055770 to 3055796 (27 bp); Cellvibrio gilvus ATCC 13127 GTCGAACGAGTCGAACGAGTCGAACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3055561-3056241	Sequence	Celgi_2752 - regulatory protein ArsR (Protein is coded in complementary strand; from 3056241 to 3055561)