Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3313549
End position: 3313575
Length: 27

DNA sequence
>NC_015671, from 3313549 to 3313575 (27 bp); Cellvibrio gilvus ATCC 13127 TGGACCCGACGGACCCGAGGGACCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3313440-3315533	Sequence	Celgi_3007 - ABC transporter related protein (Protein is coded in complementary strand; from 3315533 to 3313440)