Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 347065
End position: 347091
Length: 27

DNA sequence
>NC_015671, from 347065 to 347091 (27 bp); Cellvibrio gilvus ATCC 13127 GCGGCCGTGTCGGCCGTGGCGGCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 343228-347265	Sequence	Celgi_0311 - Mannan endo-1,4-beta-mannosidase., Cellulase (Protein is coded in complementary strand; from 347265 to 343228)