Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 63831
End position: 63857
Length: 27

DNA sequence
>NC_015671, from 63831 to 63857 (27 bp); Cellvibrio gilvus ATCC 13127 CCTCGATGACCTCGATGCCCGCGATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 63566-64519	Sequence	Celgi_0055 - band 7 protein (Protein is coded in complementary strand; from 64519 to 63566)