Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 834418
End position: 834444
Length: 27

DNA sequence
>NC_015671, from 834418 to 834444 (27 bp); Cellvibrio gilvus ATCC 13127 GGCGGCTCCGGCGGCTCCGGGGGCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 833821-835143	Sequence	Celgi_0757 - hypothetical protein (Protein is coded in complementary strand; from 835143 to 833821)