Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1134798
End position: 1134827
Length: 30

DNA sequence
>NC_015671, from 1134798 to 1134827 (30 bp); Cellvibrio gilvus ATCC 13127 CGTCGGCGTGGGCGTCGGCGTGGGTGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1134439-1135890	Sequence	Celgi_1040 - glycoside hydrolase 10 (Protein is coded in complementary strand; from 1135890 to 1134439)