Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1427640
End position: 1427669
Length: 30

DNA sequence
>NC_015671, from 1427640 to 1427669 (30 bp); Cellvibrio gilvus ATCC 13127 CCGCCGGCAGCCGCCGTCGGCCGTCGTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1427667-1428263	Sequence	Celgi_1279 - hypothetical protein (Protein is coded in complementary strand; from 1428263 to 1427667)