Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1817854
End position: 1817883
Length: 30

DNA sequence
>NC_015671, from 1817854 to 1817883 (30 bp); Cellvibrio gilvus ATCC 13127 GGGTGCTCATCGGTGCTCCTGGGTTCTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1816920-1817864	Sequence	Celgi_1668 - Glyoxalase/bleomycin resistance protein/dioxygenase (Protein is coded in complementary strand; from 1817864 to 1816920)