Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1989941
End position: 1989970
Length: 30

DNA sequence
>NC_015671, from 1989941 to 1989970 (30 bp); Cellvibrio gilvus ATCC 13127 TGCGCGTACGCGTTCGCGAGCGCGCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1989557-1990255	Sequence	Celgi_1835 - 20S proteasome subunits A/B (Protein is coded in complementary strand; from 1990255 to 1989557)