Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2743997
End position: 2744026
Length: 30

DNA sequence
>NC_015671, from 2743997 to 2744026 (30 bp); Cellvibrio gilvus ATCC 13127 GCGGTCACGGTCGCGGTCGCGGTACCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2742741-2744780	Sequence	Celgi_2477 - transcription termination factor Rho (Protein is coded in complementary strand; from 2744780 to 2742741)