Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 3128104
End position: 3128136
Length: 33

DNA sequence
>NC_015671, from 3128104 to 3128136 (33 bp); Cellvibrio gilvus ATCC 13127 GTCACGTCCGCGTCACGTCCGGGTCAGGTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3128128-3128619	Sequence	Celgi_2831 - hypothetical protein (Protein is coded in complementary strand; from 3128619 to 3128128)