Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 67921
End position: 67953
Length: 33

DNA sequence
>NC_015671, from 67921 to 67953 (33 bp); Cellvibrio gilvus ATCC 13127 CCCCACCTGACCACCGCCTGACCACCGCCTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 66209-67942	Sequence	Celgi_0060 - FAD-dependent pyridine nucleotide-disulfide oxidoreductase