Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2425823
End position: 2425857
Length: 35

DNA sequence
>NC_015671, from 2425823 to 2425857 (35 bp); Cellvibrio gilvus ATCC 13127 CCGCGTCGCGGCGCGGCGCGCGGCGCTGCGCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2425701-2427182	Sequence	Celgi_2216 - putative ABC transporter (Protein is coded in complementary strand; from 2427182 to 2425701)