Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1017301
End position: 1017336
Length: 36

DNA sequence
>NC_015671, from 1017301 to 1017336 (36 bp); Cellvibrio gilvus ATCC 13127 GTTCGACGCCGAGTTCAAGGCCGACTTCGACGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1016613-1017830	Sequence	Celgi_0932 - isocitrate dehydrogenase, NADP-dependent