Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 186265
End position: 186300
Length: 36

DNA sequence
>NC_015671, from 186265 to 186300 (36 bp); Cellvibrio gilvus ATCC 13127 AACCCGCACCGCCGCCCGCACCGCCGCCCGCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 186144-186923	Sequence	Celgi_0163 - peptidase M15B and M15C DD-carboxypeptidase VanY/endolysin