Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1900561
End position: 1900596
Length: 36

DNA sequence
>NC_015671, from 1900561 to 1900596 (36 bp); Cellvibrio gilvus ATCC 13127 AGCGCCGCCGCCAGCGCGGCCGCGACCGCCGGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1900051-1901031	Sequence	Celgi_1758 - transcriptional regulator protein-like protein (Protein is coded in complementary strand; from 1901031 to 1900051)