Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1999764
End position: 1999799
Length: 36

DNA sequence
>NC_015671, from 1999764 to 1999799 (36 bp); Cellvibrio gilvus ATCC 13127 TGCGGTGGTGGGTGCGCTGGTGGGTGCGGTGCTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1998736-1999836	Sequence	Celgi_1841 - tRNA (adenine-N(1)-)-methyltransferase (Protein is coded in complementary strand; from 1999836 to 1998736)