Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2027739
End position: 2027774
Length: 36

DNA sequence
>NC_015671, from 2027739 to 2027774 (36 bp); Cellvibrio gilvus ATCC 13127 ACTCCCGCACCCGCTCCCGTACCCGCTCGCGCACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2026961-2027782	Sequence	Celgi_1868 - von Willebrand factor A (Protein is coded in complementary strand; from 2027782 to 2026961)