Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2053977
End position: 2054012
Length: 36

DNA sequence
>NC_015671, from 2053977 to 2054012 (36 bp); Cellvibrio gilvus ATCC 13127 GTGGGCTCGGTGGTGGGCTCGGTCGTGGGTTCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2053647-2054735	Sequence	Celgi_1891 - chitin-binding domain 3 protein (Protein is coded in complementary strand; from 2054735 to 2053647)