Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2171842
End position: 2171877
Length: 36

DNA sequence
>NC_015671, from 2171842 to 2171877 (36 bp); Cellvibrio gilvus ATCC 13127 CCCGGCACGGCGCCCGGCACGGCACCCGGCGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2171713-2173218	Sequence	Celgi_1996 - UDP-N-acetylmuramoylalanine/D-glutamate ligase (Protein is coded in complementary strand; from 2173218 to 2171713)