Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2323386
End position: 2323421
Length: 36

DNA sequence
>NC_015671, from 2323386 to 2323421 (36 bp); Cellvibrio gilvus ATCC 13127 CCTCGGCCGCGGCCTTCGCCGCGGCGTCCGCCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2323199-2323831	Sequence	Celgi_2126 - dihydroxyacetone kinase, L subunit (Protein is coded in complementary strand; from 2323831 to 2323199)