Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2835113
End position: 2835148
Length: 36

DNA sequence
>NC_015671, from 2835113 to 2835148 (36 bp); Cellvibrio gilvus ATCC 13127 CTCGTCGAACCGCTCGTCGACCAGCTCGGCGAAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2833725-2835671	Sequence	Celgi_2561 - hypothetical protein (Protein is coded in complementary strand; from 2835671 to 2833725)