Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 305088
End position: 305123
Length: 36

DNA sequence
>NC_015671, from 305088 to 305123 (36 bp); Cellvibrio gilvus ATCC 13127 GGGTCGGGGTCCCGGTCGGGCTCGGCGTCGGGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 304712-306238	Sequence	Celgi_0277 - cellulose-binding family II (Protein is coded in complementary strand; from 306238 to 304712)